View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_46 (Length: 241)
Name: NF4306_low_46
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 11599274 - 11599478
Alignment:
| Q |
20 |
ataacatgtggacagatgcatgcaatataaaaagcatcaaagttttctccgaaagtatgggatattagtaaattttaattaaagtccttccatatttgga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11599274 |
ataacatgtggacagatgcatgcaatataaaaagcatcaaagttttctccgaaagtatgggatattagtaaattttaattaaagtacttccatatttgga |
11599373 |
T |
 |
| Q |
120 |
aaagaagaatccatctagttcgtgatcccatgtgggccaaatcaaggattttcattttaattatttcttcatttaggacactcgaaaacaacaaatagaa |
219 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11599374 |
aaagaagaatctatctagttcgtgatcccatgtgggccaaatcaaggattttcattttaattatttcttcatttaggacactcgaaaacaacaaaaagat |
11599473 |
T |
 |
| Q |
220 |
gttag |
224 |
Q |
| |
|
||||| |
|
|
| T |
11599474 |
gttag |
11599478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University