View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4306_low_53 (Length: 234)

Name: NF4306_low_53
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4306_low_53
NF4306_low_53
[»] chr6 (1 HSPs)
chr6 (5-218)||(30419393-30419606)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 5 - 218
Target Start/End: Complemental strand, 30419606 - 30419393
Alignment:
5 attttattttgtcagtccttatacaaatatattacttttgcttttgctccttgttttgttgttttagttcttccaactttgttcatattgaaactagtct 104  Q
    ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
30419606 atttttttttgtcagtccttatacaaatatattatttttgcttttgctccttgttttgttgttttagttcttctaactttgttcatattgaaactagtct 30419507  T
105 ttataagatgtgagtaaatttcaatacnnnnnnnnnnnnnnnnnnnnnnnnnttcacacaaagcggaggttaggggacgatgataggttacatcaatcat 204  Q
    |||||||||||||||||||||||||||                         ||||||||||||||||||||||||||| ||||||||||||||||||||    
30419506 ttataagatgtgagtaaatttcaatacgagagaggagaaagaagagagagagttcacacaaagcggaggttaggggacggtgataggttacatcaatcat 30419407  T
205 ctttctcatattac 218  Q
    ||||||||||||||    
30419406 ctttctcatattac 30419393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University