View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_55 (Length: 229)
Name: NF4306_low_55
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 28759545 - 28759328
Alignment:
| Q |
1 |
ctttttcatcatggaacatgtggggtggtggtggtaggagagaaaatgagaaagagcaagtttctgaatggggtgtttctttgaaagaatgtgaggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759545 |
ctttttcatcatggaacatgtggggtggtggtggtaggagagaaaatgagaaagagcaagtttctgaatggggtgtttctttgaaagaatgtgaggtggt |
28759446 |
T |
|
| Q |
101 |
gaaggaaaacaagaaggtttcatcgccatcgcataggaagtttggaaggaaaagagaggagaaaaaggaagagagaacaattgatagagagtatgatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759445 |
gaaggaaaacaagaaggtttcatcgccatcgcataggaagtttggaaggaaaagagaggagaaaaaggaagagagaacaattgatagagagtatgatgtt |
28759346 |
T |
|
| Q |
201 |
gtgtttgtgccatctgat |
218 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
28759345 |
gtgtttgttccatctgat |
28759328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University