View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-1 (Length: 75)
Name: NF4307-Insertion-1
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-1 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 4e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 5039310 - 5039243
Alignment:
| Q |
8 |
aattttaccataatattcagattcattttgtacgatgtgattactttgatatcgaccattttgctttg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5039310 |
aattttaccataatattcagattcattttgtacgatgtgattactttgatatcgaccattttgctttg |
5039243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 5033528 - 5033481
Alignment:
| Q |
10 |
ttttaccataatattcagattcattttgtacgatgtgattactttgat |
57 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5033528 |
ttttaccataatatttagattcattttggtcgatgtgattactttgat |
5033481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University