View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-11 (Length: 197)
Name: NF4307-Insertion-11
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 6 - 197
Target Start/End: Original strand, 15165098 - 15165289
Alignment:
| Q |
6 |
gctggtaattgactcttggtccaaaaatgtccgtggttttggtatgttacgtttgcaactgaaattaagaaatttaaaggtagtgtttaagcattggaac |
105 |
Q |
| |
|
||||||| |||| ||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15165098 |
gctggtagttgatactttgtccaaaaatgtccgtggttttggtatgttacgtctgcaactgaaattaaaaaatttaaaggtagtgtttaagcattggaac |
15165197 |
T |
 |
| Q |
106 |
tgtaatatttttggggatgttgatagacaagttcggctggctgttgctgaagtgcaccgaattcagctcttaattgatacagtgggcattac |
197 |
Q |
| |
|
||| ||| || |||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
15165198 |
cgtactatcttcggggatgttgataggcaagttcggctggctgttgatgaagtgcaccggattcagcatttaattgatacattgggcattac |
15165289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University