View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-16 (Length: 182)
Name: NF4307-Insertion-16
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 6e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 6e-45
Query Start/End: Original strand, 6 - 153
Target Start/End: Complemental strand, 53479161 - 53479014
Alignment:
| Q |
6 |
ttctttctttagcttgcattgatgggccctaatgttcgtttgatatacattgaagagatagttttaacactc-nnnnnnnctttcctcgttttggtattt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||| || ||| |
|
|
| T |
53479161 |
ttctttctttagcttgcattgatgggcc-taatgttcgtttgatatacattgaagagatagtttcaacactcttttttttctttcctcatttctgttttt |
53479063 |
T |
 |
| Q |
105 |
agaaagtgtacaacaagaacaacaatcaacccctgaaaacaacaatcaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479062 |
agaaagtgtacaacaagaacaacaatcaacccctgaaaacaacaatcaa |
53479014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University