View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-20 (Length: 106)
Name: NF4307-Insertion-20
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 3 - 106
Target Start/End: Complemental strand, 48666874 - 48666769
Alignment:
| Q |
3 |
agactaatctccgattagatgcttaatcaagacacagtttaaagtctttcgtccctctcca--aaaaagtttactctacgggtattaactttattcctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48666874 |
agactaatctccgattagatgcttaatcaagacacagtttaaagtctttcgtccctctccaagaaaaagtttactctacgggtattaactttattcctcc |
48666775 |
T |
 |
| Q |
101 |
ctcaca |
106 |
Q |
| |
|
|||||| |
|
|
| T |
48666774 |
ctcaca |
48666769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University