View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-27 (Length: 101)
Name: NF4307-Insertion-27
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 7e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 11 - 101
Target Start/End: Original strand, 46340752 - 46340842
Alignment:
| Q |
11 |
ctcttttattttgccttgcataggaagtcatcagtagacacatcactaagctggtaacggaaggaaagctaactcttattcctggtaccag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46340752 |
ctcttttattttgccttgcataggaagtcattagtagacacatcactaagctggtaagggaaggaaagctaactcttattcctggtaccag |
46340842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 38
Target Start/End: Original strand, 19593065 - 19593096
Alignment:
| Q |
7 |
tcccctcttttattttgccttgcataggaagt |
38 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
19593065 |
tcccctcttttgttttgccttgcataggaagt |
19593096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University