View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-34 (Length: 76)
Name: NF4307-Insertion-34
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 31348359 - 31348423
Alignment:
| Q |
12 |
ttagcgtccataaacaaagaatcatcgtccgaacttaattctctaacgtgcaacactgtgttttg |
76 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31348359 |
ttagcgtccataaacagagaatcatcgtccgaacttaattctctaacgtgcaacactgtgttttg |
31348423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University