View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-35 (Length: 178)
Name: NF4307-Insertion-35
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-35 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 2 - 178
Target Start/End: Original strand, 43659627 - 43659803
Alignment:
| Q |
2 |
aaaagaacatgaatatataaaacttctttataaattcatttaaggctttatctttttcaacatagaactttggtttttcccgatacatccttcacactca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
43659627 |
aaaagaacatgaatatataaaacttctttataaattcatttaaggctttatctttttcaacatagaactttggtttttcccaatacatccctcacactca |
43659726 |
T |
|
| Q |
102 |
tcactattgaatttgatgcatgaatattgagaaactgattagttctgaattaactcaattgtattccactttaatgg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43659727 |
tcactattgaatttgatgcatgaatattgagaaactgattagttctgaattaactcaattgtattccactttaatgg |
43659803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University