View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-36 (Length: 125)
Name: NF4307-Insertion-36
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-36 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 12 - 125
Target Start/End: Complemental strand, 50119960 - 50119847
Alignment:
| Q |
12 |
caacaaagccgacgccaccgccgtcggtctctccggtgtggacggaaaactcctcaccgcacgtcctagtcctaattcctcaaaccttgggttcgttggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50119960 |
caacaaagccgacgccaccgccgtcggtctctccggtgtggacggaaaactcctcaccgcacgtcctagtcctaattcctcaaaccttgggttcgttggc |
50119861 |
T |
 |
| Q |
112 |
gaggttgcaagagt |
125 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50119860 |
gaggttgcaagagt |
50119847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University