View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-37 (Length: 129)
Name: NF4307-Insertion-37
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-37 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 6393292 - 6393152
Alignment:
| Q |
1 |
ctgtcaacttgatttgtcattaaatatttttaaatagataagatgtcattcaataaatgagccctccgtcaaatctaaaaattagcacacac-------- |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6393292 |
ctgtcaacttgatttgtcattaaatatttttaaatagataagatgtcattcaataaatgagccctccgtcaaatctaaaaatt-gcacacactgacgtgt |
6393194 |
T |
|
| Q |
93 |
-----tagacgctgatgtgctcgtctacatcataattttcaa |
129 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6393193 |
aacgttagactctgatgtgctcgtctacatcataattttcaa |
6393152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University