View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-39 (Length: 90)
Name: NF4307-Insertion-39
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-39 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 18954481 - 18954396
Alignment:
| Q |
5 |
gatttgaacacggcgtgtccaaccgagttgaaagtgatgagtaacggaagcagtgtagcgtgtaaaagcgcgtgtgaagcgtttgg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18954481 |
gatttgaacacggcgtgtccaaccgagttgaaagtgatgagtaacggaagcagtgtagcgtgtaaaagcgcgtgtgaagcgtttgg |
18954396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 5 - 90
Target Start/End: Complemental strand, 14039510 - 14039425
Alignment:
| Q |
5 |
gatttgaacacggcgtgtccaaccgagttgaaagtgatgagtaacggaagcagtgtagcgtgtaaaagcgcgtgtgaagcgtttgg |
90 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
14039510 |
gatttgaacgcggcatgtccaaccgagttgaaagtgatgagtaatggcggaggtgtagcgtgtaaaagcgcgtgtgaagcgtttgg |
14039425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 90
Target Start/End: Original strand, 8798177 - 8798205
Alignment:
| Q |
62 |
gcgtgtaaaagcgcgtgtgaagcgtttgg |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8798177 |
gcgtgtaaaagcgcgtgtgaagcgtttgg |
8798205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University