View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307-Insertion-4 (Length: 81)
Name: NF4307-Insertion-4
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307-Insertion-4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 5 - 81
Target Start/End: Original strand, 36472742 - 36472818
Alignment:
| Q |
5 |
tatgcaactctaaagtaactcacatttctacgtagttttaatgtttacttaatattgtttcaaatacaaatattaat |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36472742 |
tatgcaactctaaagtaactcacatttctatgtagtcttaatgtttacttaatattgtttcaaatacaaatattaat |
36472818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University