View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307_high_11 (Length: 219)
Name: NF4307_high_11
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 6425912 - 6426097
Alignment:
| Q |
15 |
agcagagatggcaagagttacagtacaaacttggctttcacccctcctgagtacttaaggacaggtaatgtttttatcaagtttgtgtggactccggann |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6425912 |
agcagagatggcaagagttacagtacaaacttggctttcacccctcctgagtacttaaggacaggtaatgtttttatcaagtttgtgtggactccggatt |
6426011 |
T |
 |
| Q |
115 |
nnnnncgtcagaaccattggatgagcatcacacgattcacacttaaagctcgataaatgaaattttaagaaaagcaaacttggtat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6426012 |
ttttttgtcagagccattggatgagcatcacacgattcacacttaaagctcgataaatgaaattttaagaaaagcaaacttggtat |
6426097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University