View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4307_low_10 (Length: 240)
Name: NF4307_low_10
Description: NF4307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4307_low_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 5565990 - 5566210
Alignment:
| Q |
20 |
ctatcttcggttagcctgttaaagaaatggccaacgatcgatgggcaagttggccctgtcggagcaattaaataactgtttctttaattttattttttca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5565990 |
ctatcttcggttagcctgttaaagaaatggccaacagtcgacgggcaagttggccctgtcggagcaattaaataactgcttctttaattttattttttca |
5566089 |
T |
|
| Q |
120 |
actgacacaannnnnnnnattggtaatttaattagtttggtatttgaatataaagttcatttttcacttcgttgttccatttcgttgtctattcttcctc |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5566090 |
actgacacaattttttttattggtaatttaattagtttggtatttgaatataaagttcatttttcacttcgttgttccatttcgttgtctattcttcctc |
5566189 |
T |
|
| Q |
220 |
ctaagaaaggtcatgcttctc |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5566190 |
ctaagaaaggtcatgcttctc |
5566210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University