View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309-Insertion-1 (Length: 134)
Name: NF4309-Insertion-1
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309-Insertion-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 9e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 9e-68
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 46843020 - 46843153
Alignment:
| Q |
1 |
ctttccatgtcgtttttcatcaccatcttgattctattctcagaaacagtgcaaaaaagccgggggaaaagtaacactactattttatttttcaattttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843020 |
ctttccatgtcgtttttcatcaccatcttgattctattctcagaaacagtgcaaaaaagccgggggaaaagtaacactactattttatttttcaattttc |
46843119 |
T |
|
| Q |
101 |
ttagtggtttagtaaagaatattacagaggtttt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46843120 |
gtagtggtttagtaaagaatattacagaggtttt |
46843153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University