View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309-Insertion-2 (Length: 97)
Name: NF4309-Insertion-2
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309-Insertion-2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 4e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 23 - 86
Target Start/End: Original strand, 27384184 - 27384247
Alignment:
| Q |
23 |
ctatcttatgaaaggtcgcaccactgcctcactgtatgtaccacaacacagtacttactcaaaa |
86 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27384184 |
ctatcttataaaaggtcgcaccactgcctcactgtatgtaccacaacacagtacttactcaaaa |
27384247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University