View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309_high_11 (Length: 240)
Name: NF4309_high_11
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 5665162 - 5665054
Alignment:
| Q |
16 |
atgcataaaaaatgtttaagtgggaatggtagttttacatacatgaatgagttaaatataagatggaaattttttgatggaaaatgaaggaaacattgtc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5665162 |
atgcataaaaaatgtttaagtgggaatggtaattttacatacatgaatgagttaaatataagatggaaattttttgatggaaaacgaaggaaacattgtc |
5665063 |
T |
|
| Q |
116 |
aacgaatag |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
5665062 |
aacgaatag |
5665054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 135 - 222
Target Start/End: Complemental strand, 5665016 - 5664929
Alignment:
| Q |
135 |
tttcttgaggattacaattaatggtttttgtcaatcgtaaaagcatgtacattatacaagatataatcatcgaaacccatcacgatta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665016 |
tttcttgaggattacaattaatggtttttgtcaatcataaaagcatgtacattatacaagatataatcatcgaaacccatcacgatta |
5664929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University