View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309_high_12 (Length: 225)
Name: NF4309_high_12
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 37690060 - 37689882
Alignment:
| Q |
17 |
agggagaggtggattacaaaatctagcatggcatattttgcaacaagaagttggttctatgtgtcaagtatgcagtgcagaaggcacagatttaccgata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37690060 |
agggagaggtggattacaaaatctagcatggcatattttgcaacaagaagttggttctatgtgtcaagtatgcagcgcagaaggcacagatttaccgata |
37689961 |
T |
 |
| Q |
117 |
gagagagcaattaccaaagatataaattcaaagactcagagagcaaatggccaaaataccaagtcagtgtcttgttaca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37689960 |
gagagagcaattaccaaagatataaattcaaagactcagagagcaaatggccaaaataccaagtcagtgtcttgttaca |
37689882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University