View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4309_high_12 (Length: 225)

Name: NF4309_high_12
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4309_high_12
NF4309_high_12
[»] chr3 (1 HSPs)
chr3 (17-195)||(37689882-37690060)


Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 37690060 - 37689882
Alignment:
17 agggagaggtggattacaaaatctagcatggcatattttgcaacaagaagttggttctatgtgtcaagtatgcagtgcagaaggcacagatttaccgata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37690060 agggagaggtggattacaaaatctagcatggcatattttgcaacaagaagttggttctatgtgtcaagtatgcagcgcagaaggcacagatttaccgata 37689961  T
117 gagagagcaattaccaaagatataaattcaaagactcagagagcaaatggccaaaataccaagtcagtgtcttgttaca 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37689960 gagagagcaattaccaaagatataaattcaaagactcagagagcaaatggccaaaataccaagtcagtgtcttgttaca 37689882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University