View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309_high_9 (Length: 281)
Name: NF4309_high_9
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 50048316 - 50048042
Alignment:
| Q |
1 |
tctattttctcatgattattgcgttttcataataggtatgtcaaacatttattcttccccatggatctagcttccactctgccatttcagcagatatacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50048316 |
tctattttctcatgattattgcgttttcataataggtatgtcaaacatttattcttccccatggatctagcttccactctgccatttcagcagatatacc |
50048217 |
T |
 |
| Q |
101 |
aacttatagcaggcaaatcacacgacagaggggaagtctttggctttctgaacatgcttagactctggcgattgaggcgtgttagtgagctcttctcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50048216 |
aacttatagcaggcaaatcacacgacagaggggaagtctttggctttctgaacatgcttagactctggcgattgaggcgtgttagtgagctcttctcaag |
50048117 |
T |
 |
| Q |
201 |
gtatatttctttgggatatttttgtggttataaaagacattatacgtatgttctgctatttcccacaggttctgc |
275 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50048116 |
gtatatttctttaggatatttttgtggttataacagacattatacgtatgttctgctatttcccacatgttctgc |
50048042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University