View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4309_low_12 (Length: 240)

Name: NF4309_low_12
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4309_low_12
NF4309_low_12
[»] chr5 (2 HSPs)
chr5 (16-124)||(5665054-5665162)
chr5 (135-222)||(5664929-5665016)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 5665162 - 5665054
Alignment:
16 atgcataaaaaatgtttaagtgggaatggtagttttacatacatgaatgagttaaatataagatggaaattttttgatggaaaatgaaggaaacattgtc 115  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
5665162 atgcataaaaaatgtttaagtgggaatggtaattttacatacatgaatgagttaaatataagatggaaattttttgatggaaaacgaaggaaacattgtc 5665063  T
116 aacgaatag 124  Q
    |||||||||    
5665062 aacgaatag 5665054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 135 - 222
Target Start/End: Complemental strand, 5665016 - 5664929
Alignment:
135 tttcttgaggattacaattaatggtttttgtcaatcgtaaaagcatgtacattatacaagatataatcatcgaaacccatcacgatta 222  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5665016 tttcttgaggattacaattaatggtttttgtcaatcataaaagcatgtacattatacaagatataatcatcgaaacccatcacgatta 5664929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University