View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309_low_14 (Length: 213)
Name: NF4309_low_14
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 14 - 150
Target Start/End: Complemental strand, 26687194 - 26687058
Alignment:
| Q |
14 |
aaaataaactaaaggaaaaggaccaccctatcgtgtaggttagcacgatgttgatttcataacatacctacaatacaacttatttgcccataaattgaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26687194 |
aaaataaactaaaggaaaaggaccaccctatcgtgtaggttagcacgatgttgatttcataacacacctccaatacaacttatttgcccataaattgaat |
26687095 |
T |
|
| Q |
114 |
tttctgttaccagtcgtacacggcgtttatgctatca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26687094 |
tttctgttaccagtcgtacacggcgtttctgctatca |
26687058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 14 - 150
Target Start/End: Complemental strand, 26956925 - 26956789
Alignment:
| Q |
14 |
aaaataaactaaaggaaaaggaccaccctatcgtgtaggttagcacgatgttgatttcataacatacctacaatacaacttatttgcccataaattgaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26956925 |
aaaataaactaaaggaaaaggaccaccctatcgtgtaggttagcacgatgttgatttcataacacacctccaatacaacttatttgcccataaattgaat |
26956826 |
T |
|
| Q |
114 |
tttctgttaccagtcgtacacggcgtttatgctatca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26956825 |
tttctgttaccagtcgtacacggcgtttctgctatca |
26956789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University