View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4309_low_5 (Length: 397)
Name: NF4309_low_5
Description: NF4309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4309_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 67 - 364
Target Start/End: Complemental strand, 10342295 - 10341999
Alignment:
| Q |
67 |
ttatggtattgatgtatatttcgaagatgatcaaggagattgagatttctaaaggtgttaacacttttgattatggcatcaaaaatcttaagttcccctt |
166 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10342295 |
ttatggtattgatgtatatttggaagatgatcaaggagatttagatttctaaaggtgttaacacttttgattatggcatcaaaaatcttaagttcccctt |
10342196 |
T |
|
| Q |
167 |
nnnnnnnnnntataaaatcttaggttatacgatttcttccagcaaattttaatttagtttaaaatcttattaatgcacatatgaaaccgaccatgtaatc |
266 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10342195 |
aaaaaaaaa-tctaaaatcttaggttatacgatttcttccagcaaattttaatttagtttaaaattttattaatgcacatatgaaaccgaccatgtaatc |
10342097 |
T |
|
| Q |
267 |
taaatgctgtacataatgccacgatgtattgtgtattaattgaatcctttaagacatttgtcttttgtcgcataatgcatgcaaaacaataatgtatt |
364 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10342096 |
taaatgctgtatataatgccacgatgtattgtgtattaattgaatcctttaagacatttgtcttttgtcgcataatgcatgcaaaacaataatgtatt |
10341999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University