View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4310-Insertion-1 (Length: 161)
Name: NF4310-Insertion-1
Description: NF4310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4310-Insertion-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 20246124 - 20245967
Alignment:
| Q |
1 |
cttactatgtttatacttctaatggaccttcttctattgtgattacaccggttttgaatcactctaattatcacgtttgggctcattcaaatgaggaaaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20246124 |
cttactacgtttatacttctaatggaccttcttctattgtgattacaccggttttgaatcactctaattatcacgtttgggctcattcaaatgaggaaaa |
20246025 |
T |
|
| Q |
101 |
ctcatggaggtaagaataagtttaatttggtttatggttcaattctagtcccattgga |
158 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20246024 |
ctcatggaggtaagaataagtttgatttggtttatggttcaattctagtcccattgga |
20245967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University