View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4310-Insertion-7 (Length: 106)
Name: NF4310-Insertion-7
Description: NF4310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4310-Insertion-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 3e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 3e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 30239514 - 30239409
Alignment:
| Q |
1 |
agtgctatgtcagtgtccaattcctttgtcattaacaattagcactaaagtaggaaagaccaattttgtctatggtcccaactccaagcaccatccatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239514 |
agtgctatgtcagtgtccaattcctttgtcattaacaattagcactaaagtaggaaagaccatttttgtctatggtcccaactccaagcaccatccatca |
30239415 |
T |
 |
| Q |
101 |
ctccta |
106 |
Q |
| |
|
|||||| |
|
|
| T |
30239414 |
ctccta |
30239409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University