View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4310-Insertion-9 (Length: 45)
Name: NF4310-Insertion-9
Description: NF4310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4310-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 15910939 - 15910983
Alignment:
| Q |
1 |
attatatgtttttgccatgtcaatcatatgagatgatactattga |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15910939 |
attatatgtttttgccatgtcaatcatatgagatgatactattga |
15910983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University