View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4310_high_8 (Length: 260)
Name: NF4310_high_8
Description: NF4310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4310_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 33866157 - 33866047
Alignment:
| Q |
16 |
ctaactaccatactttagcaattttaaaaactagacgagtcccataaatataaatttacaaatgtgatatttattgttgaatggagatagtgtcgtaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33866157 |
ctaactaccatactttagcaattttaaaaactagatgagtcccataaatataaatttacaaatgtgatatttattgttgaatggagatagtgtcgtaaaa |
33866058 |
T |
 |
| Q |
116 |
tacatacacac |
126 |
Q |
| |
|
|||| |||||| |
|
|
| T |
33866057 |
tacacacacac |
33866047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 144 - 223
Target Start/End: Complemental strand, 33866005 - 33865927
Alignment:
| Q |
144 |
ctcaaaagtaaaaaatatgaaaatacgtaaaagatttacctgctacatgcaaacaataatattttattcaaaagagttta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33866005 |
ctcaaaagtaaaaaatatgaaaatacgtaaaagatttacctgctacatgcaaacaataata-tttattcaaaagagttta |
33865927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 221 - 255
Target Start/End: Complemental strand, 33865904 - 33865870
Alignment:
| Q |
221 |
ttacggaattacggtactggtatcttctttctctg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33865904 |
ttacggaattacggtactggtatcttctttctctg |
33865870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University