View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4311_low_7 (Length: 245)
Name: NF4311_low_7
Description: NF4311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4311_low_7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 29084304 - 29084078
Alignment:
| Q |
19 |
cctaatgcatcaaatgtgcaccggcgaccatatttgaccgaccaccccggaacactcgttagtttaacagctggaatctggtggtcggaagtggcggcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29084304 |
cctaatgcatcaaatgtgcaccggcgaccatattcgaccgaccaccccggaacactcgttagtttaacagctggaatctggtggtcggaagtggcggcgt |
29084205 |
T |
|
| Q |
119 |
gcatgcctgcaccggcgagtgtgccggtcaatatagtataagggaaattgtttgttacggtgaatatgctagagatagataaaagataataaagtaaaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29084204 |
gcatgcctgcaccggcgagtgtgccggtcaatatagtataagggaaattgtttgttacggtgaatatgctagagatagaaaaaagataataaagtaaaaa |
29084105 |
T |
|
| Q |
219 |
caaaataaatgaaacttaggagtttcc |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29084104 |
caaaataaatgaaacttaggagtttcc |
29084078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 122 - 245
Target Start/End: Complemental strand, 29091522 - 29091400
Alignment:
| Q |
122 |
tgcctgcaccggcgagtgtgccggtcaatatagtataagggaaattgtttgttacggtgaatatgctagagatagataaaagataataaagtaaaaacaa |
221 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||||||| |||||||||||| |||||||||| |||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
29091522 |
tgcctgcaccggcgagtgtgcctggccatatagtataagggcaattgtttgttatggtgaatatggtagagaaaga-aaaagataacaaagtaaaaacaa |
29091424 |
T |
|
| Q |
222 |
aataaatgaaacttaggagtttcc |
245 |
Q |
| |
|
|| |||||||||||| |||||||| |
|
|
| T |
29091423 |
aaaaaatgaaacttaagagtttcc |
29091400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University