View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312-Insertion-1 (Length: 52)
Name: NF4312-Insertion-1
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312-Insertion-1 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 4e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 3375588 - 3375633
Alignment:
| Q |
7 |
aggatatacaaaaataaagttttgcttgctaatctatagcttgatg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3375588 |
aggatatacaaaaataaagttttgcttgctaatctatagcttgatg |
3375633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 3350187 - 3350220
Alignment:
| Q |
8 |
ggatatacaaaaataaagttttgcttgctaatct |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3350187 |
ggatatacaaaaataaagttttgcttgctaatct |
3350220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University