View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312-Insertion-4 (Length: 153)
Name: NF4312-Insertion-4
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 4e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 31 - 153
Target Start/End: Original strand, 8569506 - 8569628
Alignment:
| Q |
31 |
tacttaaaattcaagtaagttagaattagaagttaatataaatttgacagtgttgaaatctcttttaatctatggacaacttcaaataatgttgtttaat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8569506 |
tacttaaaattcaagtaagttagaattagaagttaatataaatttgacagtgttgaaatctcttttaatctatggacaacttcaaataatcttgtttaat |
8569605 |
T |
|
| Q |
131 |
tatattatagattgcatgaggca |
153 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8569606 |
tatattatagattgcatgaggca |
8569628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University