View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4312-Insertion-4 (Length: 153)

Name: NF4312-Insertion-4
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4312-Insertion-4
NF4312-Insertion-4
[»] chr2 (1 HSPs)
chr2 (31-153)||(8569506-8569628)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 4e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 31 - 153
Target Start/End: Original strand, 8569506 - 8569628
Alignment:
31 tacttaaaattcaagtaagttagaattagaagttaatataaatttgacagtgttgaaatctcttttaatctatggacaacttcaaataatgttgtttaat 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
8569506 tacttaaaattcaagtaagttagaattagaagttaatataaatttgacagtgttgaaatctcttttaatctatggacaacttcaaataatcttgtttaat 8569605  T
131 tatattatagattgcatgaggca 153  Q
    |||||||||||||||||||||||    
8569606 tatattatagattgcatgaggca 8569628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University