View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312_high_18 (Length: 225)
Name: NF4312_high_18
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 45693406 - 45693600
Alignment:
| Q |
18 |
acatgatctgtgtaaaaagatcagaaaaaatatcgcgttagaatggatataatataatgtgaaatatcaaaattcaaaggattgaagggaaaatgtaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693406 |
acatgatctgtgtaaaaagatcagaaaaaatatcgcattagaatggatataatataatgtgaaatatcaaaattcaaaggattgaagggaaaatgtaaaa |
45693505 |
T |
|
| Q |
118 |
gggaagagaaagaatacttgcagttggagttgaagtgatttaagatactcaattgcctcatctagcattgaagctttatccgcctaagaattatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
45693506 |
gggaagagaaagaatacttgcagttggagttgaagtgatttaagatactcaattgcctcatccagcattgaagctttatccgcctaagaaatatc |
45693600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 132 - 203
Target Start/End: Complemental strand, 37935757 - 37935686
Alignment:
| Q |
132 |
tacttgcagttggagttgaagtgatttaagatactcaattgcctcatctagcattgaagctttatccgccta |
203 |
Q |
| |
|
|||||| | |||||| ||||||| ||| |||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
37935757 |
tacttgaacttggagctgaagtgtttttagatactcaattgcctcatccagcatagaagctttatccaccta |
37935686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University