View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312_low_16 (Length: 312)
Name: NF4312_low_16
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 6855219 - 6855518
Alignment:
| Q |
1 |
actttgatctcttgtactctgtgggccttaaacatggaatccccccttatgaaccctctttccattaacaatgcattttggtccactagctctcttccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855219 |
actttgatctcttgtactctgtgggccttaaacatggaatccccccttatgaaccctctttccattaacaatgcattttggtccactagctctcttccta |
6855318 |
T |
 |
| Q |
101 |
gttgtcggtaaacaagcttcccatcaagggttttgacaacccggactgtatataactacatttccaccatacttattcccaccaacatgaaaacaagcat |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855319 |
gttgtcggtaaacaagcttcccatcgagggttttgacaacccggactgtatataactacatttccaccatacttattcccaccaacatgaaaacaagcat |
6855418 |
T |
 |
| Q |
201 |
taacaatatcttatttttcaggccacgaagcgcaatttgcaaagttcnnnnnnntctatttatccacagagaaatatcatcactaaaaataaggaagaat |
300 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855419 |
taacaatatattatttttcaggccacgaagcgcaatttgcaaagttcaaaaaaatctatttatccacagagaaatatcatcactaaaaataaggaagaat |
6855518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 119
Target Start/End: Complemental strand, 24242532 - 24242462
Alignment:
| Q |
50 |
tgaaccctctttccattaacaatgcattttggtccactagctctcttcctagttgtc-ggtaaacaagctt |
119 |
Q |
| |
|
|||| |||||||||| ||||| |||||| |||||||||||||||||| | |||||| | ||||||||||| |
|
|
| T |
24242532 |
tgaatcctctttccagtaacagggcatttaggtccactagctctcttcttggttgtctgataaacaagctt |
24242462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University