View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312_low_18 (Length: 291)
Name: NF4312_low_18
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 275
Target Start/End: Complemental strand, 35045872 - 35045616
Alignment:
| Q |
9 |
aaattactcaataaa-catcatgtattgtgtaagcttcttgtggtccttaaccgctacatgctctttttattttgttttccaagtttgaagaaatagcat |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35045872 |
aaattactcaataaaacatcatgtattgtgtaagcttcttgtggtccttaaccgctacatgctctttttattttgttttccgagtttgaagaaat----- |
35045778 |
T |
 |
| Q |
108 |
ttgaaatagcaaatattatcgtacccttgatggcgacaaagcttattggtttttcatgacaatatgcatgcata-nnnnnnnnctttcttagtagacaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35045777 |
-------agcaaatattatcgtacccttgatggcgacaaagcttattggtttttcatgacaatatgcatgcatatttttttttctttcttagtagacaat |
35045685 |
T |
 |
| Q |
207 |
ccactatacattgcacccttcaaaaataaatccactacacattgtacggttatatatatacgggggttg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35045684 |
ccactatacattgcacccttcaaaaataaatccactacacattgtacggttatatatatacgggggttg |
35045616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University