View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312_low_25 (Length: 243)
Name: NF4312_low_25
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 25877896 - 25878097
Alignment:
| Q |
19 |
ttgagactctttaacactctttcaa-caactccaactcttttatatcttaactcaaactaaataagttatccaactcgcatgtgtaacattttaagcttg |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25877896 |
ttgagactctttaacactctttcaaacaactccaactcttttatatcttaactcaaactaaataagttatccaactcgcacgtgtaacattttaagcttg |
25877995 |
T |
|
| Q |
118 |
caaaagctgtgatnnnnnnntgcatgcacccaaaaaaggaaaactgaagtaaaatgcaagcttagatagagagaacttgtcaaattttaaggaatcttct |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25877996 |
caaaagctgtgataaaaaaatgcatgcacccaaaaaaggaaaactgaagtaaaatgcaagcttagatagagagaacttgtcaaattttaaggaatcttct |
25878095 |
T |
|
| Q |
218 |
tt |
219 |
Q |
| |
|
|| |
|
|
| T |
25878096 |
tt |
25878097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University