View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4312_low_33 (Length: 204)
Name: NF4312_low_33
Description: NF4312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4312_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 25616359 - 25616538
Alignment:
| Q |
9 |
gaagcaaaggaagaagctgcaccaacaattgtggctaagacaaagatggtacaaagaaaatatccctcgagagtatgcgttagnnnnnnnngggcagaga |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25616359 |
gaagaaaaggaagaagctgcaccaacaattgtggctaagacaaagatggtacaaagaaaatatccctcgagagtatgtgttagaaaagaaaaggcagaga |
25616458 |
T |
 |
| Q |
109 |
ctttagctacaattgtgacaaagaagggtataccaagaaaaaatcctgctcctctttctgttattttagtagactgatat |
188 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25616459 |
cgttagctacaattgtgacaaagaagggtataccaagaaaaaatcctgctcctctttctgttattttagtagactgatat |
25616538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University