View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313-Insertion-10 (Length: 198)
Name: NF4313-Insertion-10
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 6 - 198
Target Start/End: Original strand, 5194483 - 5194671
Alignment:
| Q |
6 |
cttcaaatactcgatatgtccttcaaagaagagagcaaatgacctgaattttttagtcagtcaaaatgcttctgcagctcggaattgcggaatacatcct |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5194483 |
cttcaaatacttgatatgtccttcaaagaagagagcaaatgacctgaattttttag-cagtcaaaatgcttctgcagctcggaattgcggaatacatcct |
5194581 |
T |
|
| Q |
106 |
gataggaatatttgtatatcttaaagcttctatgaagggaatgagcttccttacggcgccgacacattctacaccgaaagactctcatcatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
5194582 |
gataggaatatttgtatatcttaaagcttctatgacgggaatgagcttccttacgg---cgacacattctacaccgaaatactctcatcatta |
5194671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 63 - 159
Target Start/End: Complemental strand, 44714730 - 44714634
Alignment:
| Q |
63 |
cagtcaaaatgcttctgcagctcggaattgcggaatacatcctgataggaatatttgtatatcttaaagcttctatgaagggaatgagcttccttac |
159 |
Q |
| |
|
|||||||| |||||||| ||||| |||| |||||| |||||||||||||||||| ||| |||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
44714730 |
cagtcaaagtgcttctgtagctccgaatggcggaaaacatcctgataggaatatcggtaaatctgaaaccttctatgaatggaatgagcttccttac |
44714634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University