View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313-Insertion-13 (Length: 94)
Name: NF4313-Insertion-13
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313-Insertion-13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 3e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 27306713 - 27306794
Alignment:
| Q |
13 |
ttaatgtgctcgtgaactattaagtctccactcgtgaacttcatcaatgcacacaacacatgattgattggctttgcttctg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27306713 |
ttaatgtgctcgtgaactattaagtctccactcgtgaacttcatcaatgcacacaacacatgattgattggctttgcttctg |
27306794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University