View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313-Insertion-15 (Length: 138)
Name: NF4313-Insertion-15
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313-Insertion-15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 7459406 - 7459286
Alignment:
| Q |
1 |
ggaagtagtgttttagatatagataatgcattcataaaacatgtccaattaaaagagattttctttctaacaatcatctcaaacattccatatcaagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7459406 |
ggaagtagtgttttagatatagataatgcattcataaaacatgtccaattaaaagagattttctttctaacaatcatctcaaacattccatatcaagtga |
7459307 |
T |
 |
| Q |
101 |
aatatcttaaacttaatcgat |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7459306 |
aatatcttaaacttaatcgat |
7459286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University