View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313-Insertion-2 (Length: 198)
Name: NF4313-Insertion-2
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313-Insertion-2 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 6e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 6e-42
Query Start/End: Original strand, 75 - 198
Target Start/End: Complemental strand, 52560148 - 52560025
Alignment:
| Q |
75 |
taactctttgtgcttcgtaaccttgttgataaaaatttgttagccaaaatt--gacatttgatagcccaagagtttgaggtcttggttctattgaagtga |
172 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
52560148 |
taactctttgtgcttc-tacccttgttgataaaattttgttagccaaaattttgacatttgatagcccaaga-tttgaggtcttggttctattgaactga |
52560051 |
T |
|
| Q |
173 |
gttttgtggaggcgttttatggtatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52560050 |
gttttgtggaggcgttttatggtatg |
52560025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 52560098 - 52560039
Alignment:
| Q |
5 |
ttgacatttgatagcccaagatttgaggtcttggttctattgaagtgagttttgtggagg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52560098 |
ttgacatttgatagcccaagatttgaggtcttggttctattgaactgagttttgtggagg |
52560039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University