View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313-Insertion-6 (Length: 161)
Name: NF4313-Insertion-6
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313-Insertion-6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 49705348 - 49705188
Alignment:
| Q |
1 |
aaaacgacgttgaagaattcccgggaacacgctgacaatcaatcttaattaaaaagtaatcctcccctttcttagattgagcagcttgaccaattcttac |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49705348 |
aaaacgacgttgaagagttcccgggaacgcgctgacaatcaatcttaattaaaaagtaatcctcccctttcttagattgggcagcttgaccaattcttac |
49705249 |
T |
|
| Q |
101 |
agtaggcttctccatcttctcacttttcatctctctcttaagcaatgcagcaagaggcaca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705248 |
agtaggcttctccatcttctcacttttcatctctctcttaagcaatgcagcaagaggcaca |
49705188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University