View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313_high_7 (Length: 249)
Name: NF4313_high_7
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313_high_7 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 49623642 - 49623411
Alignment:
| Q |
19 |
tgacctagaccaaatatatatata--attgagatgaactttttggcttttagtttgagttcatatgttattgtgttatcaggattgttttcttggcagca |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623642 |
tgacctagaccaaatatatatatataattgagatgaattttttggcttttagtttgagttcatatgttattgtgttatcaggattgttttcttggcagca |
49623543 |
T |
 |
| Q |
117 |
gaagcgtgcttgttggcagcatctgttatgaatgcaatccaaaattcgtatcttaatgagtattttttagggcatgatttgtcttgcctcatactcagca |
216 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623542 |
gaagcatgcttgctggcagcatctgttatgaatgcaatccaaaatgcgtat-ttaatgagtattttttagggcatgatttgtcttgcctcatactcagca |
49623444 |
T |
 |
| Q |
217 |
aaggtgtgtttgctgctggagctgccttgatct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49623443 |
aaggtgtgtttgctgctggagctgccttgatct |
49623411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 246
Target Start/End: Complemental strand, 49603168 - 49603136
Alignment:
| Q |
214 |
gcaaaggtgtgtttgctgctggagctgccttga |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
49603168 |
gcaaaggtgtgtttgctgctggggctgccttga |
49603136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University