View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4313_low_11 (Length: 222)
Name: NF4313_low_11
Description: NF4313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4313_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 49623333 - 49623117
Alignment:
| Q |
1 |
ggcaaaatacacaacctcgttcctgaacttgaaatggcctaaagatttactgctttgaatacggttaggctttaatttacatagttttggttgttcggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49623333 |
ggcaaaatacacaacctcgttcctgaacttgaaatggcctaaagatttactgctttgaatacggttaggctttaatttacataattttggttgttcggaa |
49623234 |
T |
|
| Q |
101 |
accttgttgggtagagtatatgtgatatttacgccgtgataggagaatgtttgaaacattatagatggtagtagtactgtagtatggcggggtttcaata |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49623233 |
acctagttgggtagagtatatgtgatatttacgccgtgataggagaatgcttgaaacattatagatggtagta-----gtagtatggcggggtttcaata |
49623139 |
T |
|
| Q |
201 |
tattattgtttcaagtttgaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49623138 |
tattattgtttcaagtttgaaa |
49623117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University