View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4314-Insertion-13 (Length: 215)
Name: NF4314-Insertion-13
Description: NF4314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4314-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 38732087 - 38732301
Alignment:
| Q |
1 |
acaattcttctctaagttttctttttaattatgcaggtagcatgcttgcaggcacaattgatgcaagtgaaatctcagctgtcacataacatagagaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38732087 |
acaattcttctctaagttttctttttaattatgcaggtagcatgcttgcaggcacaattgatgcaagtgaaatctcagctgtcacataacatagagaata |
38732186 |
T |
 |
| Q |
101 |
ataatcagtggataggaaacaataataatgttgctgccacacaagcaatgaattatccattttgtccaacttatatgaaccctatatctcctcaaagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38732187 |
ataatcagtggataggaaacaataataatgttgctgccacacaagcaatgaattatccattttgtccaacttatatgaaccctatatctcctcaaagctc |
38732286 |
T |
 |
| Q |
201 |
acttgagtcatcaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38732287 |
acttgagtcatcaat |
38732301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University