View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4314-Insertion-8 (Length: 182)
Name: NF4314-Insertion-8
Description: NF4314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4314-Insertion-8 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 1e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 100 - 182
Target Start/End: Complemental strand, 5798850 - 5798768
Alignment:
| Q |
100 |
gcaacaattacgtttcatttacctttttacccttcttctttttacagggacgatggcttccaagttcaaccatcgtttgaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5798850 |
gcaacaattacgtttcatttacctttttacccttcttctttttacagggacgatggcttccaagttcaaccatcgtttgaagc |
5798768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5798953 - 5798905
Alignment:
| Q |
1 |
gaaggcgccgctattcaatccctcggttctctcttcaacgttacccaag |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5798953 |
gaaggcgccgctattcaatccctcggttctctcttcaacgttacccaag |
5798905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University