View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4314-Insertion-9 (Length: 229)
Name: NF4314-Insertion-9
Description: NF4314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4314-Insertion-9 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 37798251 - 37798474
Alignment:
| Q |
1 |
aaacctttatgccgagggtattgctttaacctcagcaacatttatgctagctatgttcaaccttactccaggcattaccttcatcatggcaatattattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37798251 |
aaacctttatgccgagggtattgctttaacctcagcaacatttatgctagctatgttcaaccttactccaggcattaccttcatcatggcaatattattt |
37798350 |
T |
|
| Q |
101 |
gggtactcactctatactcgttatacctttcttgttttcaaaacaacatgtgaattcgactctaagacattattccacgactttgcatttctttctttct |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
37798351 |
gggtactcactc-atactcgttatacctttcttgttttcaaaacaacttgtgaattcgactctaagacattattccacgacttcgca----tttctttct |
37798445 |
T |
|
| Q |
201 |
aaatgcttaaggttgcccaatacgctgcc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37798446 |
aaatgcttaaggttgcccaatacgctgcc |
37798474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 24 - 111
Target Start/End: Original strand, 37789467 - 37789554
Alignment:
| Q |
24 |
ctttaacctcagcaacatttatgctagctatgttcaaccttactccaggcattaccttcatcatggcaatattatttgggtactcact |
111 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
37789467 |
ctttaacctcatcaacatttatgttcgctatgttcaaccttactccaggcattaccttcatcatggcaatattcttcgggtactcact |
37789554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University