View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4315-Insertion-6 (Length: 265)
Name: NF4315-Insertion-6
Description: NF4315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4315-Insertion-6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 8 - 200
Target Start/End: Original strand, 19503592 - 19503764
Alignment:
| Q |
8 |
tttttagcatctgtcatgtggtagtggtacttcccttggttgttttgactagcccagaggctgtg-tttttcaaattgtgttagggtgggattgcattcc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19503592 |
tttttagcatctgtcatgtggtagtggtactctccttggttgttttgactagcccagaggctgtgttttttcaaattgtgttagggtgggattgcattcc |
19503691 |
T |
|
| Q |
107 |
ttttgcttctgttttgacatgttgtgttggttttcagctgctttaggaatatatgttggggaatgataattgttagtgctcacttttggctagg |
200 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19503692 |
ttttg----------ga-----------ggttttcagctgctttaggaatatatgttgtggaatgataattgttagtgctcacttttggctagg |
19503764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 243
Target Start/End: Original strand, 19503860 - 19503894
Alignment:
| Q |
209 |
ttgtgatttacccctcttttgttccttttaattta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19503860 |
ttgtgatttacccctcttttgttccttttaattta |
19503894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University