View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4315_low_10 (Length: 302)
Name: NF4315_low_10
Description: NF4315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4315_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 2129710 - 2129424
Alignment:
| Q |
1 |
aggtaaatggctaccttgttttgaatctgatagtgatgagaaatcaaacaaagtagattgatctctttaggtttacaatcaaaactagttgaatttgaaa |
100 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2129710 |
aggtaaatggctacctggttt-gaatctgatagtgatgagaaatcaaacaaagtagattgatctctttaggtttacaatcaaaactagttgaatttgaaa |
2129612 |
T |
 |
| Q |
101 |
gcaaaagtggaatttgatgagcaagtatccaacaatgtgttc-acacaatgcaattcaatgatgatgattctcggtgatacaaaacaactgacaagggct |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2129611 |
gcaaaagcggaatttgatgagcaagtatccaacaatgtgttcgacacaatgcaattcaatgatgatgattctcggtgataaaaaacaactgacaagggct |
2129512 |
T |
 |
| Q |
200 |
ggattcagattaaggtgaccggtgaattctatcatttgaagaaagataaggtgtggataagcatcaatgacatctcttaaaacaaaac |
287 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2129511 |
ggattcagattgaggtgaccggtgaattctatcatttggagaaagataaggtgtggacaagcatcaatcacatctcttaaaacaaaac |
2129424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 2119059 - 2119008
Alignment:
| Q |
22 |
tgaatctgatagtgatgagaaatcaaacaaagtagattgatctctttaggtt |
73 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2119059 |
tgaatccgatagtgttgagaaatcaaacaaggtagatagatctctttaggtt |
2119008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University