View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4316-Insertion-1 (Length: 110)
Name: NF4316-Insertion-1
Description: NF4316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4316-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 18 - 110
Target Start/End: Original strand, 2668454 - 2668545
Alignment:
| Q |
18 |
agaacaatttccctcatgacttcaagagaatctagactattttcacgtcttaattctcttgtcttcttgcagttttttattttaatgtttaag |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
2668454 |
agaacaatttccttcatgacttcaagagaatctagactattttcacgttttaattctcttgtcttcttgcagttcttta-tttaatgtttaag |
2668545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University