View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4316_high_11 (Length: 254)
Name: NF4316_high_11
Description: NF4316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4316_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 27111916 - 27112152
Alignment:
| Q |
7 |
caaagaacattctcaggtcttgaaatagcttctctttggataggactagtggttggtgtcccttcttactatctagctggttctttagttgatcttggta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27111916 |
caaagaacattctcaggtcttgaaatagcttctctttggataggactagttgttggtgttccatcttactatctagctggttccttagttgatcttggta |
27112015 |
T |
 |
| Q |
107 |
tgtcatggtggcaaggaatctccacagttgttcttgccaacatcatacttttgttcccacttattcttactggccatgcaggtacaaaatatggcatatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27112016 |
tgtcatggtggcaaggaatctccacagttgttcttgccaacatcattcttttattcccacttattcttactggccatgcaggtacaaaatatggcatatc |
27112115 |
T |
 |
| Q |
207 |
attcccagttcttgccagatcctcttttggtattcat |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27112116 |
attcccagttcttgctagatcctcttttggtattcat |
27112152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University